Construct: ORF TRCN0000479151
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017317.1_s317c1
- Derived from:
- ccsbBroadEn_07887
- DNA Barcode:
- GGTATGAACATTTCTAGCAGCTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GCAT (23464)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479151
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23464 | GCAT | glycine C-acetyltransferase | NM_014291.3 | 99.8% | 99.5% | 115C>T;1159C>T |
| 2 | human | 23464 | GCAT | glycine C-acetyltransferase | XM_017028677.2 | 99.8% | 99.5% | 115C>T;1159C>T |
| 3 | human | 23464 | GCAT | glycine C-acetyltransferase | XM_005261411.2 | 96.6% | 96.3% | 115C>T;986_1027del;1201C>T |
| 4 | human | 23464 | GCAT | glycine C-acetyltransferase | NM_001171690.1 | 94% | 93.7% | 115C>T;195_272del;1237C>T |
| 5 | human | 23464 | GCAT | glycine C-acetyltransferase | XM_005261410.4 | 94% | 93.7% | 115C>T;195_272del;1237C>T |
| 6 | human | 23464 | GCAT | glycine C-acetyltransferase | XM_005261409.4 | 91.1% | 90.8% | (many diffs) |
| 7 | human | 23464 | GCAT | glycine C-acetyltransferase | XM_017028676.2 | 84.5% | 84.2% | (many diffs) |
| 8 | human | 23464 | GCAT | glycine C-acetyltransferase | XM_017028675.2 | 82.5% | 82.2% | (many diffs) |
| 9 | human | 23464 | GCAT | glycine C-acetyltransferase | XM_017028674.2 | 80.2% | 80% | (many diffs) |
| 10 | human | 23464 | GCAT | glycine C-acetyltransferase | XR_002958677.1 | 69.1% | (many diffs) | |
| 11 | human | 23464 | GCAT | glycine C-acetyltransferase | XM_024452183.1 | 56.9% | 56.8% | 0_1ins540;619C>T |
| 12 | human | 23464 | GCAT | glycine C-acetyltransferase | XM_011530023.2 | 55.1% | 54.9% | 0_1ins540;446_487del;661C>T |
| 13 | mouse | 26912 | Gcat | glycine C-acetyltransferase... | NM_013847.4 | 85.5% | 90.2% | (many diffs) |
| 14 | mouse | 26912 | Gcat | glycine C-acetyltransferase... | NM_001161712.1 | 77.4% | 78.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1323
- ORF length:
- 1257
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gcctgggaac gcctggcgcg ccgcactctt ctgggtgccc cgcggccgcc 121 gcgcacagtc agcgctggcc cagctgcgtg gcattctgga gggggagctg gaaggcatct 181 gcggagctgg cacttggaag agtgagcggg tcatcacgtc ccgtcagggg ccgcacatcc 241 gcgtggacgg cgtctccgga ggaatcctta acttctgtgc caacaactac ctgggcctga 301 gcagccaccc tgaggtgatc caggcaggtc tgcaggctct ggaggagttt ggagctggcc 361 tcagctctgt ccgctttatc tgtggaaccc agagcatcca caagaatcta gaagcaaaaa 421 tagcccgctt ccaccagcgg gaggatgcca tcctctatcc cagctgttat gacgccaacg 481 ccggcctctt tgaggccctg ctgaccccag aggacgcagt cctgtcggac gagctgaacc 541 atgcctccat catcgacggc atccggctgt gcaaggccca caagtaccgc tatcgccacc 601 tggacatggc cgacctagaa gccaagctgc aggaggccca gaagcatcgg ctgcgcctgg 661 tggccactga tggggccttt tccatggatg gcgacatcgc acccctgcag gagatctgct 721 gcctcgcctc tagatatggt gccctggtct tcatggatga atgccatgcc actggcttcc 781 tggggcccac aggacggggc acagatgagc tgctgggtgt gatggaccag gtcaccatca 841 tcaactccac cctggggaag gccctgggtg gagcatcagg gggctacacg acagggcctg 901 ggcccctggt gtccctgctg cggcagcgcg cccggccata cctcttctcc aacagtctgc 961 cacctgctgt cgttggctgc gcctccaagg ccctagatct gctgatgggG AGTAACACCA 1021 TTGTCCAGTC TATGGCTGCC AAGACCCAGA GGTTCCGTAG TAAGATGGAA GCTGCTGGCT 1081 TCACTATCTC GGGAGCCAGT CACCCCATCT GCCCTGTGAT GCTGGGTGAT GCCCGGCTGG 1141 CCTCTCGCAT GGCGGATGAC ATGCTGAAGA GAGGCATCTT TGTCATCGGG TTCAGCTACC 1201 CCGTGGTCCC CAAGGGCAAG GCCTGGATCC GGGTACAGAT CTCAGCAGTG CATAGCGAGG 1261 AAGACATTGA CCGCTGCGTG GAGGCCTTCG TGGAAGTGGG GCGACTGCAC GGGGCACTGC 1321 CCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1381 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1441 GGCTTTATAT ATCTTGTGGA AAGGACGAGG TATGAACATT TCTAGCAGCT AAACGCGTTA 1501 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt