Transcript: Mouse NM_001163637.1

Mus musculus janus kinase and microtubule interacting protein 2 (Jakmip2), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Jakmip2 (76217)
Length:
3511
CDS:
472..2934

Additional Resources:

NCBI RefSeq record:
NM_001163637.1
NBCI Gene record:
Jakmip2 (76217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347423 GGGAATCCGAACGGGATATAC pLKO_005 1070 CDS 100% 13.200 18.480 N Jakmip2 n/a
2 TRCN0000347419 GCCAAGACTATGTGCTTTAAA pLKO_005 3069 3UTR 100% 15.000 10.500 N Jakmip2 n/a
3 TRCN0000347350 GGCTCTTGACCAGGCATATAT pLKO_005 2592 CDS 100% 15.000 10.500 N Jakmip2 n/a
4 TRCN0000347420 AGAATCTGAGCTACGATTTAG pLKO_005 1887 CDS 100% 13.200 9.240 N Jakmip2 n/a
5 TRCN0000347421 GTCCTGGTGACCGAGCTTAAA pLKO_005 673 CDS 100% 13.200 9.240 N Jakmip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02255 pDONR223 100% 88.4% 96.6% None (many diffs) n/a
2 ccsbBroad304_02255 pLX_304 0% 88.4% 96.6% V5 (many diffs) n/a
3 TRCN0000481259 TGGACTTACAACCAGCCCTACCCT pLX_317 17.5% 88.4% 96.6% V5 (many diffs) n/a
Download CSV