Transcript: Mouse NM_029938.1

Mus musculus H2A histone family, member V (H2afv), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
H2afv (77605)
Length:
1636
CDS:
105..491

Additional Resources:

NCBI RefSeq record:
NM_029938.1
NBCI Gene record:
H2afv (77605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093032 TGCTGTGTACAGTGCCGCAAT pLKO.1 257 CDS 100% 4.050 5.670 N H2afv n/a
2 TRCN0000093030 GTTAGCAGGTAATGCTTCCAA pLKO.1 308 CDS 100% 3.000 4.200 N H2afv n/a
3 TRCN0000093031 AGATCTCAAAGTGAAGCGCAT pLKO.1 329 CDS 100% 2.160 1.728 N H2afv n/a
4 TRCN0000093028 GTGTTGGAGTTAGCAGGTAAT pLKO.1 300 CDS 100% 10.800 7.560 N H2afv n/a
5 TRCN0000093029 GCAATTCTGGAGTACCTCACA pLKO.1 273 CDS 100% 2.640 1.848 N H2afv n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04620 pDONR223 100% 91.6% 100% None (many diffs) n/a
2 ccsbBroad304_04620 pLX_304 0% 91.6% 100% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000470909 TCCATAAACAGCCGTATAATACCA pLX_317 70.4% 91.6% 100% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV