Transcript: Mouse NM_029716.3

Mus musculus chimerin 1 (Chn1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Chn1 (108699)
Length:
3251
CDS:
254..886

Additional Resources:

NCBI RefSeq record:
NM_029716.3
NBCI Gene record:
Chn1 (108699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112397 GCCCTGAACGACATACGCTAT pLKO.1 815 CDS 100% 4.050 5.670 N Chn1 n/a
2 TRCN0000112399 GAAGGCGGATATTTCTGTGAA pLKO.1 478 CDS 100% 4.950 3.960 N Chn1 n/a
3 TRCN0000112395 GCCTAATATGTGCAAAGGATT pLKO.1 2649 3UTR 100% 4.950 3.465 N Chn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00303 pDONR223 100% 41.1% 44.6% None (many diffs) n/a
2 ccsbBroad304_00303 pLX_304 0% 41.1% 44.6% V5 (many diffs) n/a
3 TRCN0000474759 TCATCAGAACGTTGCGGATCAGGG pLX_317 21.9% 41.1% 44.6% V5 (many diffs) n/a
Download CSV