Transcript: Mouse NM_025360.2

Mus musculus transmembrane p24 trafficking protein 3 (Tmed3), mRNA.

Source:
NCBI, updated 2019-02-22
Taxon:
Mus musculus (mouse)
Gene:
Tmed3 (66111)
Length:
1324
CDS:
119..784

Additional Resources:

NCBI RefSeq record:
NM_025360.2
NBCI Gene record:
Tmed3 (66111)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025360.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113144 CCCGAGCTGAAGACCTTAATA pLKO.1 639 CDS 100% 15.000 21.000 N Tmed3 n/a
2 TRCN0000309439 CCCGAGCTGAAGACCTTAATA pLKO_005 639 CDS 100% 15.000 21.000 N Tmed3 n/a
3 TRCN0000113143 GCAGTATGACAGCTTCACGTA pLKO.1 379 CDS 100% 2.640 3.696 N Tmed3 n/a
4 TRCN0000309511 GCAGTATGACAGCTTCACGTA pLKO_005 379 CDS 100% 2.640 3.696 N Tmed3 n/a
5 TRCN0000113142 CTCTCATAAGACCGTCTACTT pLKO.1 457 CDS 100% 4.950 3.465 N Tmed3 n/a
6 TRCN0000113141 GCGTGAAGTTCTCTCTGGATT pLKO.1 273 CDS 100% 4.950 3.465 N Tmed3 n/a
7 TRCN0000309437 GCGTGAAGTTCTCTCTGGATT pLKO_005 273 CDS 100% 4.950 3.465 N Tmed3 n/a
8 TRCN0000113140 GCCAGTGATCTAGCATCCAAT pLKO.1 1016 3UTR 100% 4.950 2.970 N Tmed3 n/a
9 TRCN0000309513 GCCAGTGATCTAGCATCCAAT pLKO_005 1016 3UTR 100% 4.950 2.970 N Tmed3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025360.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02764 pDONR223 100% 84% 88.2% None (many diffs) n/a
2 ccsbBroad304_02764 pLX_304 0% 84% 88.2% V5 (many diffs) n/a
3 TRCN0000471079 GATCCCCTTTATACCTCCTTTTGA pLX_317 83.9% 84% 88.2% V5 (many diffs) n/a
Download CSV