Transcript: Human NM_001205329.1

Homo sapiens junctional adhesion molecule 3 (JAM3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
JAM3 (83700)
Length:
3515
CDS:
160..939

Additional Resources:

NCBI RefSeq record:
NM_001205329.1
NBCI Gene record:
JAM3 (83700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179108 CCTGAACATTGGCGGAATTAT pLKO.1 723 CDS 100% 15.000 21.000 N JAM3 n/a
2 TRCN0000350806 CCAATCCCAGATTTCGCAATT pLKO_005 563 CDS 100% 10.800 15.120 N JAM3 n/a
3 TRCN0000323188 TGGAACTGTCTTGCATCATTA pLKO_005 305 CDS 100% 13.200 9.240 N JAM3 n/a
4 TRCN0000323115 GCACATACCTCTGCTAGAAAC pLKO_005 977 3UTR 100% 10.800 7.560 N JAM3 n/a
5 TRCN0000152394 GAAGTCTATGACCTGAACATT pLKO.1 712 CDS 100% 5.625 3.938 N JAM3 n/a
6 TRCN0000154916 GAGCAGGAGATGGAAGTCTAT pLKO.1 700 CDS 100% 4.950 3.465 N JAM3 n/a
7 TRCN0000323114 GAGCAGGAGATGGAAGTCTAT pLKO_005 700 CDS 100% 4.950 3.465 N JAM3 n/a
8 TRCN0000151747 CAGGAATTTGAAAGTGTGGAA pLKO.1 289 CDS 100% 2.640 1.848 N JAM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04290 pDONR223 100% 83.5% 83.5% None 255_256ins153 n/a
2 ccsbBroad304_04290 pLX_304 0% 83.5% 83.5% V5 255_256ins153 n/a
3 TRCN0000477899 TCTACCTTGATCAAGGCTTGGAAA pLX_317 52.2% 83.5% 83.5% V5 255_256ins153 n/a
Download CSV