Transcript: Human NM_001207024.1

Homo sapiens mannose-6-phosphate receptor, cation dependent (M6PR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
M6PR (4074)
Length:
2325
CDS:
276..851

Additional Resources:

NCBI RefSeq record:
NM_001207024.1
NBCI Gene record:
M6PR (4074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001207024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029687 CTGCCGTTCTAAACCTCGAAA pLKO.1 746 CDS 100% 4.950 6.930 N M6PR n/a
2 TRCN0000322977 CTGCCGTTCTAAACCTCGAAA pLKO_005 746 CDS 100% 4.950 6.930 N M6PR n/a
3 TRCN0000322978 CCTCATCTCACCCTTACTATT pLKO_005 938 3UTR 100% 13.200 10.560 N M6PR n/a
4 TRCN0000029686 CACATCTTCAACGGAAGTAAT pLKO.1 603 CDS 100% 13.200 9.240 N M6PR n/a
5 TRCN0000322975 CACATCTTCAACGGAAGTAAT pLKO_005 603 CDS 100% 13.200 9.240 N M6PR n/a
6 TRCN0000029688 CCAGGGTTCAGACACATACAT pLKO.1 470 CDS 100% 5.625 3.938 N M6PR n/a
7 TRCN0000029684 GCTCTAGTGAAGAGGCTGAAA pLKO.1 414 CDS 100% 4.950 3.465 N M6PR n/a
8 TRCN0000322974 GCTCTAGTGAAGAGGCTGAAA pLKO_005 414 CDS 100% 4.950 3.465 N M6PR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001207024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00957 pDONR223 100% 68.9% 68.9% None 453_454ins258 n/a
2 ccsbBroad304_00957 pLX_304 0% 68.9% 68.9% V5 453_454ins258 n/a
3 TRCN0000473952 CGGATTCAATTTGAATGCTCTTAT pLX_317 52.1% 68.9% 68.9% V5 453_454ins258 n/a
Download CSV