Transcript: Human NM_022552.4

Homo sapiens DNA methyltransferase 3 alpha (DNMT3A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
DNMT3A (1788)
Length:
4324
CDS:
268..3006

Additional Resources:

NCBI RefSeq record:
NM_022552.4
NBCI Gene record:
DNMT3A (1788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022552.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430317 GGTAGCGACACAAAGTTAAAC pLKO_005 3027 3UTR 100% 13.200 18.480 N DNMT3A n/a
2 TRCN0000359100 CGCTCCGCTGAAGGAGTATTT pLKO_005 2973 CDS 100% 13.200 10.560 N DNMT3A n/a
3 TRCN0000035754 CCCAAGGTCAAGGAGATTATT pLKO.1 1660 CDS 100% 15.000 10.500 N DNMT3A n/a
4 TRCN0000418113 GGCATCCACTGTGAATGATAA pLKO_005 2682 CDS 100% 13.200 9.240 N DNMT3A n/a
5 TRCN0000359101 TCCAGATGTTCTTCGCTAATA pLKO_005 2081 CDS 100% 13.200 9.240 N DNMT3A n/a
6 TRCN0000231274 AGAGGGACATCTCGCGATTTC pLKO_005 2564 CDS 100% 10.800 7.560 N Dnmt3a n/a
7 TRCN0000433210 AGCGTCACACAGAAGCATATC pLKO_005 2332 CDS 100% 10.800 7.560 N DNMT3A n/a
8 TRCN0000035758 CCACCAGAAGAAGAGAAGAAT pLKO.1 1537 CDS 100% 5.625 3.938 N DNMT3A n/a
9 TRCN0000035755 CCGGCTCTTCTTTGAGTTCTA pLKO.1 2451 CDS 100% 4.950 3.465 N DNMT3A n/a
10 TRCN0000035756 GCCTCAGAGCTATTACCCAAT pLKO.1 517 CDS 100% 4.050 2.835 N DNMT3A n/a
11 TRCN0000035757 CCAGATGTTCTTCGCTAATAA pLKO.1 2082 CDS 100% 15.000 9.000 N DNMT3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022552.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00454 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00454 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473305 TCCTGATCAGAATGGATACCCTAC pLX_317 14.2% 100% 100% V5 n/a
Download CSV