Transcript: Mouse NM_001252591.2

Mus musculus small muscle protein, X-linked (Smpx), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Smpx (66106)
Length:
1070
CDS:
360..617

Additional Resources:

NCBI RefSeq record:
NM_001252591.2
NBCI Gene record:
Smpx (66106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252591.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125133 AGGCGAATATCAATATTCCAA pLKO.1 397 CDS 100% 0.300 0.420 N Smpx n/a
2 TRCN0000125130 TGTTGTCAACTTGTCTGAGAT pLKO.1 548 CDS 100% 4.950 3.960 N Smpx n/a
3 TRCN0000125129 GCAAATCAGCACACGAATTTA pLKO.1 834 3UTR 100% 15.000 10.500 N Smpx n/a
4 TRCN0000125132 CAATTCCTGGAATGAAGAAAT pLKO.1 517 CDS 100% 13.200 9.240 N Smpx n/a
5 TRCN0000423837 ATATTCCAATGGGAGCCTTTC pLKO_005 409 CDS 100% 6.000 4.200 N SMPX n/a
6 TRCN0000125131 GCCATCCAGGCGAATATCAAT pLKO.1 390 CDS 100% 5.625 3.938 N Smpx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252591.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02829 pDONR223 100% 82.1% 84% None (many diffs) n/a
2 ccsbBroad304_02829 pLX_304 0% 82.1% 84% V5 (many diffs) n/a
3 TRCN0000478623 ATACTGCGGGGCTCACACCGGCGC pLX_317 100% 82.1% 84% V5 (many diffs) n/a
Download CSV