Transcript: Mouse XM_006529398.1

PREDICTED: Mus musculus erythrocyte membrane protein band 4.1 like 5 (Epb41l5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Epb41l5 (226352)
Length:
6720
CDS:
428..2623

Additional Resources:

NCBI RefSeq record:
XM_006529398.1
NBCI Gene record:
Epb41l5 (226352)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529398.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247048 TGAGGAGCTAACCCGGTATTT pLKO_005 820 CDS 100% 13.200 18.480 N Epb41l5 n/a
2 TRCN0000247047 TTCGACTAGGATCCCGATTTA pLKO_005 1443 CDS 100% 13.200 18.480 N Epb41l5 n/a
3 TRCN0000183607 GCTTATAATCTGCAAGCTGAA pLKO.1 917 CDS 100% 4.050 5.670 N Epb41l5 n/a
4 TRCN0000257742 GTTCAGTTGGCAGCTTATAAT pLKO_005 905 CDS 100% 15.000 10.500 N Epb41l5 n/a
5 TRCN0000257629 TATGAGTATCCCATAACATTT pLKO_005 4358 3UTR 100% 13.200 9.240 N Epb41l5 n/a
6 TRCN0000247046 TTCGACCTACCATTGACATTA pLKO_005 1989 CDS 100% 13.200 9.240 N Epb41l5 n/a
7 TRCN0000196175 GCAGTTCAGTTGGCAGCTTAT pLKO.1 902 CDS 100% 10.800 7.560 N Epb41l5 n/a
8 TRCN0000195988 CCAGCACCATTCTTGGTAGAT pLKO.1 2525 CDS 100% 4.950 3.465 N Epb41l5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529398.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03838 pDONR223 100% 59.1% 57.3% None (many diffs) n/a
2 ccsbBroad304_03838 pLX_304 0% 59.1% 57.3% V5 (many diffs) n/a
Download CSV