Transcript: Mouse NM_027287.4

Mus musculus DnaJ heat shock protein family (Hsp40) member B4 (Dnajb4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Dnajb4 (67035)
Length:
2570
CDS:
281..1294

Additional Resources:

NCBI RefSeq record:
NM_027287.4
NBCI Gene record:
Dnajb4 (67035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112231 GCGATGAAACACCAAATAGTA pLKO.1 939 CDS 100% 5.625 7.875 N Dnajb4 n/a
2 TRCN0000112230 GCATGGTTGTAATGTTCGTAA pLKO.1 1875 3UTR 100% 4.950 6.930 N Dnajb4 n/a
3 TRCN0000112232 CCTCCCATTATTCATGAACTT pLKO.1 752 CDS 100% 4.950 3.960 N Dnajb4 n/a
4 TRCN0000112233 GAGGTCGAGATTCTGAAGAAA pLKO.1 633 CDS 100% 5.625 3.938 N Dnajb4 n/a
5 TRCN0000112234 GCCAACAATGGACGGAAGAAA pLKO.1 1087 CDS 100% 5.625 3.938 N Dnajb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02616 pDONR223 100% 90.5% 94% None (many diffs) n/a
2 ccsbBroad304_02616 pLX_304 0% 90.5% 94% V5 (many diffs) n/a
3 TRCN0000472325 GATACGGGAGTCCTCCATCTTTTT pLX_317 40.8% 90.5% 94% V5 (many diffs) n/a
Download CSV