Transcript: Human NM_001286111.1

Homo sapiens autophagy related 5 (ATG5), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
ATG5 (9474)
Length:
2890
CDS:
354..629

Additional Resources:

NCBI RefSeq record:
NM_001286111.1
NBCI Gene record:
ATG5 (9474)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150645 GATTCATGGAATTGAGCCAAT pLKO.1 700 3UTR 100% 4.050 5.670 N ATG5 n/a
2 TRCN0000330323 GATTCATGGAATTGAGCCAAT pLKO_005 700 3UTR 100% 4.050 5.670 N ATG5 n/a
3 TRCN0000330395 AGATTGAAGGATCAACTATTT pLKO_005 805 3UTR 100% 13.200 9.240 N ATG5 n/a
4 TRCN0000151963 CCTGAACAGAATCATCCTTAA pLKO.1 827 3UTR 100% 10.800 7.560 N ATG5 n/a
5 TRCN0000330394 CCTGAACAGAATCATCCTTAA pLKO_005 827 3UTR 100% 10.800 7.560 N ATG5 n/a
6 TRCN0000150976 CCAGATATTCTGGAATGGAAA pLKO.1 2224 3UTR 100% 4.950 3.465 N ATG5 n/a
7 TRCN0000151474 CCTTTCATTCAGAAGCTGTTT pLKO.1 572 CDS 100% 4.950 3.465 N ATG5 n/a
8 TRCN0000330392 CCTTTCATTCAGAAGCTGTTT pLKO_005 572 CDS 100% 4.950 3.465 N ATG5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02173 pDONR223 100% 33% 13.8% None 108_109ins370;273_274ins182 n/a
2 ccsbBroad304_02173 pLX_304 81.1% 33% 13.8% V5 108_109ins370;273_274ins182 n/a
3 TRCN0000474030 TTCTCCACCGCGACTTCCTGCAGG pLX_317 59.4% 33% 13.8% V5 108_109ins370;273_274ins182 n/a
Download CSV