Transcript: Human NM_001287442.1

Homo sapiens jade family PHD finger 1 (JADE1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
JADE1 (79960)
Length:
5644
CDS:
154..2682

Additional Resources:

NCBI RefSeq record:
NM_001287442.1
NBCI Gene record:
JADE1 (79960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360164 CAGCGATGCTACGACAATATG pLKO_005 691 CDS 100% 13.200 10.560 N JADE1 n/a
2 TRCN0000363302 TGAATCCGGATGAGTACTATG pLKO_005 344 CDS 100% 10.800 8.640 N JADE1 n/a
3 TRCN0000019619 CGACAATATGAATCATGCCAT pLKO.1 702 CDS 100% 2.640 2.112 N JADE1 n/a
4 TRCN0000019620 CGGGAGCAGGATGTCTTATTT pLKO.1 1591 CDS 100% 15.000 10.500 N JADE1 n/a
5 TRCN0000019623 GCAGCGATGCTACGACAATAT pLKO.1 690 CDS 100% 13.200 9.240 N JADE1 n/a
6 TRCN0000019622 GCCTGAGGAAGTAGTGGATTT pLKO.1 1479 CDS 100% 10.800 7.560 N JADE1 n/a
7 TRCN0000019621 GTCAACTACTTGGTCCCAGAA pLKO.1 210 CDS 100% 4.050 2.835 N JADE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04153 pDONR223 100% 60.2% 59.7% None (many diffs) n/a
2 ccsbBroad304_04153 pLX_304 0% 60.2% 59.7% V5 (many diffs) n/a
3 TRCN0000473040 AGTAGGCCGCTGGACCCCAATTAC pLX_317 32.3% 60.2% 59.7% V5 (many diffs) n/a
Download CSV