Transcript: Human NR_104038.1

Homo sapiens INO80 complex ATPase subunit (INO80), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
INO80 (54617)
Length:
6225
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104038.1
NBCI Gene record:
INO80 (54617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104038.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365462 TGTAATCACCCGGAGTTATTT pLKO_005 2763 3UTR 100% 15.000 21.000 N INO80 n/a
2 TRCN0000370589 CATGAGTCGCAAACGAGATAT pLKO_005 1511 3UTR 100% 13.200 18.480 N INO80 n/a
3 TRCN0000370591 CCCTAAAGCCATACCACATTT pLKO_005 2818 3UTR 100% 13.200 18.480 N INO80 n/a
4 TRCN0000365461 TACGGGTACAACGTGTCTAAA pLKO_005 4621 3UTR 100% 13.200 18.480 N INO80 n/a
5 TRCN0000365521 GGATGACAGTAATCCATTATT pLKO_005 482 3UTR 100% 15.000 12.000 N INO80 n/a
6 TRCN0000365460 GGATCCCTTAATACAAGTTAA pLKO_005 515 3UTR 100% 13.200 10.560 N INO80 n/a
7 TRCN0000107558 CGTAACCTGTTTCTCACCAAT pLKO.1 1215 3UTR 100% 4.950 3.960 N INO80 n/a
8 TRCN0000107556 GCCCAGAAGAACTGTAAGGAA pLKO.1 1290 3UTR 100% 3.000 2.400 N INO80 n/a
9 TRCN0000370590 TCTATATGAACAGGGTATTAA pLKO_005 1910 3UTR 100% 15.000 10.500 N INO80 n/a
10 TRCN0000365523 GCTAGTAAGGGAGATTGTATA pLKO_005 5296 3UTR 100% 13.200 9.240 N INO80 n/a
11 TRCN0000107557 GCTGCTATATCAGGCACTAAA pLKO.1 2633 3UTR 100% 13.200 9.240 N INO80 n/a
12 TRCN0000107555 GCAGTTGTGTTCCCAGCAATT pLKO.1 5450 3UTR 100% 10.800 7.560 N INO80 n/a
13 TRCN0000107559 CCCTTAATACAAGTTAAGGAA pLKO.1 519 3UTR 100% 0.300 0.210 N INO80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104038.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03442 pDONR223 100% 71.4% None 1_317del;3589_3590ins128;4858_6225del n/a
2 ccsbBroad304_03442 pLX_304 0% 71.4% V5 1_317del;3589_3590ins128;4858_6225del n/a
3 TRCN0000476169 TTCGTGAAGTAGAACACGTTCACA pLX_317 8.5% 71.4% V5 1_317del;3589_3590ins128;4858_6225del n/a
Download CSV