Transcript: Human NM_001300919.1

Homo sapiens high mobility group AT-hook 2 (HMGA2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
HMGA2 (8091)
Length:
1878
CDS:
812..1255

Additional Resources:

NCBI RefSeq record:
NM_001300919.1
NBCI Gene record:
HMGA2 (8091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352779 CCAAGAGGCAGACCTAGGAAA pLKO_005 1037 CDS 100% 4.950 3.465 N HMGA2 n/a
2 TRCN0000021966 AGTCCCTCTAAAGCAGCTCAA pLKO.1 986 CDS 100% 4.050 2.835 N HMGA2 n/a
3 TRCN0000342671 AGTCCCTCTAAAGCAGCTCAA pLKO_005 986 CDS 100% 4.050 2.835 N HMGA2 n/a
4 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1200 CDS 100% 4.950 2.475 Y n/a
5 TRCN0000126046 CCCTCTCCTAAGAGACCCAGA pLKO.1 938 CDS 100% 0.720 0.360 Y Hmga2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15487 pDONR223 0% 36.7% 31.9% None (many diffs) n/a
2 ccsbBroad304_15487 pLX_304 0% 36.7% 31.9% V5 (many diffs) n/a
3 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 36.7% 31.9% V5 (many diffs) n/a
Download CSV