Transcript: Human NM_001282599.1

Homo sapiens catenin alpha 2 (CTNNA2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CTNNA2 (1496)
Length:
2946
CDS:
184..1938

Additional Resources:

NCBI RefSeq record:
NM_001282599.1
NBCI Gene record:
CTNNA2 (1496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282599.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435394 GTTCGCATTGGCGCAATATTT pLKO_005 2197 3UTR 100% 15.000 21.000 N CTNNA2 n/a
2 TRCN0000421543 TGTACTAGCCAATACGCTTAA pLKO_005 2377 3UTR 100% 10.800 15.120 N CTNNA2 n/a
3 TRCN0000412374 TAAGATGAGATGAGATCAATA pLKO_005 2077 3UTR 100% 13.200 9.240 N CTNNA2 n/a
4 TRCN0000148903 CCAGAAGAACTAGAGGATGAT pLKO.1 1117 CDS 100% 4.950 3.465 N CTNNA2 n/a
5 TRCN0000150270 GAAACCAATGTTCCTTTGCTA pLKO.1 400 CDS 100% 3.000 2.100 N CTNNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282599.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06063 pDONR223 100% 62.7% 60.6% None (many diffs) n/a
2 ccsbBroad304_06063 pLX_304 0% 62.7% 60.6% V5 (many diffs) n/a
Download CSV