Transcript: Human NM_001304364.1

Homo sapiens zinc finger and BTB domain containing 26 (ZBTB26), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-12-16
Taxon:
Homo sapiens (human)
Gene:
ZBTB26 (57684)
Length:
2137
CDS:
213..1538

Additional Resources:

NCBI RefSeq record:
NM_001304364.1
NBCI Gene record:
ZBTB26 (57684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219086 GAACTACGCCAACCATTTAAA pLKO_005 1070 CDS 100% 15.000 21.000 N ZBTB26 n/a
2 TRCN0000257111 TGCGTGTGCATGCCGGAATTA pLKO_005 1162 CDS 100% 13.200 18.480 N ZBTB26 n/a
3 TRCN0000107412 CCCTTCTTAAGAGACCAATTT pLKO.1 378 CDS 100% 13.200 10.560 N ZBTB26 n/a
4 TRCN0000219007 AGATGTCTTTGGCCCTAATAT pLKO_005 977 CDS 100% 15.000 10.500 N ZBTB26 n/a
5 TRCN0000107413 CCCAAGCTGTCCTGAACTTAA pLKO.1 1492 CDS 100% 13.200 9.240 N ZBTB26 n/a
6 TRCN0000107411 CCACAATTATGCCCTTTCTTA pLKO.1 923 CDS 100% 5.625 3.938 N ZBTB26 n/a
7 TRCN0000107414 CCAAAGTGTACCAGGGTGTTT pLKO.1 1038 CDS 100% 4.950 3.465 N ZBTB26 n/a
8 TRCN0000107410 CCTAACATTGACTTATGTCTT pLKO.1 1796 3UTR 100% 4.950 3.465 N ZBTB26 n/a
9 TRCN0000095521 CCTTGTATTCATCCATCTGAA pLKO.1 702 CDS 100% 4.950 3.465 N Zbtb26 n/a
10 TRCN0000229962 CAATTGCTCTTATCCTGTTAT pLKO_005 459 CDS 100% 13.200 7.920 N ZBTB26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03839 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03839 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471375 GGAGCCGGTTCTAATCGTCATGGT pLX_317 32% 100% 100% V5 n/a
Download CSV