Transcript: Human XM_005273100.2

PREDICTED: Homo sapiens TATA-box binding protein associated factor 5 like (TAF5L), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAF5L (27097)
Length:
3088
CDS:
409..1902

Additional Resources:

NCBI RefSeq record:
XM_005273100.2
NBCI Gene record:
TAF5L (27097)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234360 ACGTACCCGCTGAGGATATAT pLKO_005 1378 CDS 100% 15.000 21.000 N TAF5L n/a
2 TRCN0000307478 ACGTACCCGCTGAGGATATAT pLKO_005 1378 CDS 100% 15.000 21.000 N Taf5l n/a
3 TRCN0000234359 AGACGTGTCCCGCATCCATTT pLKO_005 1059 CDS 100% 10.800 15.120 N TAF5L n/a
4 TRCN0000015750 CCACCCTAATTCAAACTACTT pLKO.1 1434 CDS 100% 4.950 6.930 N TAF5L n/a
5 TRCN0000015748 CGGCCAATCTAACAGTGCAAT pLKO.1 185 5UTR 100% 4.950 6.930 N TAF5L n/a
6 TRCN0000015751 GCTTCGAGCATTCCTAGATAA pLKO.1 594 CDS 100% 13.200 10.560 N TAF5L n/a
7 TRCN0000015749 CGCATCCATTTGGCTTGTGAT pLKO.1 1069 CDS 100% 4.950 3.960 N TAF5L n/a
8 TRCN0000218431 ATCTGGACATCAGTCCATATA pLKO_005 1298 CDS 100% 1.320 1.056 N TAF5L n/a
9 TRCN0000234358 GTTTGGACGACTGCGGAATTT pLKO_005 276 5UTR 100% 13.200 9.240 N TAF5L n/a
10 TRCN0000234361 GATCCTGGCAAATAGTCTTTC pLKO_005 2367 3UTR 100% 10.800 7.560 N TAF5L n/a
11 TRCN0000015752 CCTGCCAAGAGAACAGACTAT pLKO.1 733 CDS 100% 4.950 3.465 N TAF5L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08053 pDONR223 100% 39.3% 39.3% None (many diffs) n/a
2 ccsbBroad304_08053 pLX_304 0% 39.3% 39.3% V5 (many diffs) n/a
3 TRCN0000465591 TCGGGACCCTACAGAATTAAACAT pLX_317 31.9% 39.3% 39.3% V5 (many diffs) n/a
Download CSV