Transcript: Human XM_006724039.2

PREDICTED: Homo sapiens PR/SET domain 15 (PRDM15), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRDM15 (63977)
Length:
6505
CDS:
26..3490

Additional Resources:

NCBI RefSeq record:
XM_006724039.2
NBCI Gene record:
PRDM15 (63977)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240942 CGCTCAAGAGGAGCTTAATTC pLKO_005 1167 CDS 100% 13.200 18.480 N PRDM15 n/a
2 TRCN0000240941 AGCCGCAAAGAGAGCCTAAAG pLKO_005 1361 CDS 100% 10.800 15.120 N PRDM15 n/a
3 TRCN0000240943 CGCATGGTGACAAGCTGTTTA pLKO_005 1314 CDS 100% 13.200 10.560 N PRDM15 n/a
4 TRCN0000168302 GCTCCTCAATGAACATCTGTT pLKO.1 766 CDS 100% 4.950 3.465 N PRDM15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12439 pDONR223 100% 91.4% 91.4% None (many diffs) n/a
Download CSV