Transcript: Human XR_938778.1

PREDICTED: Homo sapiens tetratricopeptide repeat domain 29 (TTC29), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC29 (83894)
Length:
2000
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_938778.1
NBCI Gene record:
TTC29 (83894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_938778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160421 CTGGCCTGTTACTTCAATAAT pLKO.1 750 3UTR 100% 15.000 21.000 N TTC29 n/a
2 TRCN0000160215 CCAAGGTCTCAATTGATCAAA pLKO.1 402 3UTR 100% 5.625 7.875 N TTC29 n/a
3 TRCN0000159373 GTAAGGAACCACTTCTATGAA pLKO.1 786 3UTR 100% 5.625 7.875 N TTC29 n/a
4 TRCN0000159051 GATGCTTACAGTGAACAACTA pLKO.1 1692 3UTR 100% 4.950 6.930 N TTC29 n/a
5 TRCN0000161950 GCTGCGAGATGGTTATCATAA pLKO.1 530 3UTR 100% 13.200 9.240 N TTC29 n/a
6 TRCN0000159136 GCTTACAGTGAACAACTATAT pLKO.1 1695 3UTR 100% 13.200 9.240 N TTC29 n/a
7 TRCN0000159432 GCTTCTGAAATAGCCAAAGAA pLKO.1 1092 3UTR 100% 5.625 3.938 N TTC29 n/a
8 TRCN0000160542 CATTATGAAGCATTCCATCAA pLKO.1 924 3UTR 100% 4.950 3.465 N TTC29 n/a
9 TRCN0000159896 GAAGAATATCTGTGTGGACAT pLKO.1 509 3UTR 100% 4.050 2.835 N TTC29 n/a
10 TRCN0000159897 GAGCATTATGAAGCATTCCAT pLKO.1 921 3UTR 100% 3.000 2.100 N TTC29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_938778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12761 pDONR223 100% 47.7% None (many diffs) n/a
2 ccsbBroad304_12761 pLX_304 0% 47.7% V5 (many diffs) n/a
3 TRCN0000471567 ATGCAAACGTCTATAATAAGTCAA pLX_317 36.7% 47.7% V5 (many diffs) n/a
Download CSV