Transcript: Human XM_011534419.1

PREDICTED: Homo sapiens complexin 2 (CPLX2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPLX2 (10814)
Length:
4993
CDS:
613..1017

Additional Resources:

NCBI RefSeq record:
XM_011534419.1
NBCI Gene record:
CPLX2 (10814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420844 TATTAGGTTAAGTCTCAATTC pLKO_005 1082 3UTR 100% 10.800 15.120 N CPLX2 n/a
2 TRCN0000180782 GCAGCAGATCCGAGATAAGTA pLKO.1 801 CDS 100% 5.625 4.500 N CPLX2 n/a
3 TRCN0000444144 TCCTGGACACGGTGCTCAAAT pLKO_005 959 CDS 100% 13.200 9.240 N CPLX2 n/a
4 TRCN0000180948 GAGAAGGAAGCAGAGGAGAAA pLKO.1 841 CDS 100% 4.950 2.970 N CPLX2 n/a
5 TRCN0000179646 GCAGGACATGTTCAAGAAGTA pLKO.1 996 CDS 100% 4.950 2.970 N CPLX2 n/a
6 TRCN0000180407 GCTGCAGGACATGTTCAAGAA pLKO.1 993 CDS 100% 4.950 2.970 N CPLX2 n/a
7 TRCN0000180582 GCTGAAGAAGAAGGAGGAGAA pLKO.1 825 CDS 100% 4.050 2.430 N CPLX2 n/a
8 TRCN0000381054 GCCGCTGCAGGACATGTTCAA pLKO_005 990 CDS 100% 1.650 0.990 N Cplx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02535 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02535 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477153 GGACGACTTTAAAGACCGGTCGCG pLX_317 89.8% 100% 100% V5 n/a
Download CSV