Transcript: Mouse XM_006540008.2

PREDICTED: Mus musculus zinc finger protein 146 (Zfp146), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp146 (26465)
Length:
2853
CDS:
725..1603

Additional Resources:

NCBI RefSeq record:
XM_006540008.2
NBCI Gene record:
Zfp146 (26465)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086367 CGTCGCTGATTGTGCATGTGA pLKO.1 1314 CDS 100% 3.000 4.200 N Zfp146 n/a
2 TRCN0000235338 ACTCATTAAACGCCCTGAATA pLKO_005 1595 CDS 100% 13.200 10.560 N Zfp146 n/a
3 TRCN0000086366 AGCTCATCTCTAACCGTGCAT pLKO.1 1394 CDS 100% 2.640 2.112 N Zfp146 n/a
4 TRCN0000235336 GAGAATCCATTCAGGCGATAA pLKO_005 1333 CDS 100% 10.800 7.560 N Zfp146 n/a
5 TRCN0000086364 TCAGCCACAAATCGAATCTTA pLKO.1 798 CDS 100% 5.625 3.938 N Zfp146 n/a
6 TRCN0000235337 ACCCTACGGGTGCAATGAATG pLKO_005 1438 CDS 100% 10.800 6.480 N Zfp146 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07166 pDONR223 100% 85.7% 95.2% None (many diffs) n/a
2 ccsbBroad304_07166 pLX_304 0% 85.7% 95.2% V5 (many diffs) n/a
3 TRCN0000470510 CGGGCCCGCTCCGTTGCACCGGGG pLX_317 41.2% 85.7% 95.2% V5 (many diffs) n/a
Download CSV