Transcript: Mouse XM_006539680.2

PREDICTED: Mus musculus ribosomal protein S19 (Rps19), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rps19 (20085)
Length:
769
CDS:
293..730

Additional Resources:

NCBI RefSeq record:
XM_006539680.2
NBCI Gene record:
Rps19 (20085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340316 GTTCCATGACCAAGATCTATG pLKO_005 510 CDS 100% 10.800 7.560 N Rps19 n/a
2 TRCN0000104264 TGGTTCCATGACCAAGATCTA pLKO.1 508 CDS 100% 4.950 3.465 N Rps19 n/a
3 TRCN0000104263 CGGTGTCAGACCCAGCCATTT pLKO.1 547 CDS 100% 3.600 2.520 N Rps19 n/a
4 TRCN0000340315 TAACCAGCAGGAGTTCGTCAG pLKO_005 319 CDS 100% 2.250 1.575 N Rps19 n/a
5 TRCN0000340314 CATTTCAGCAGAGGCTCTAAG pLKO_005 563 CDS 100% 10.800 6.480 N Rps19 n/a
6 TRCN0000340391 ATATGATGAGAACTGGTTCTA pLKO_005 433 CDS 100% 4.950 2.970 N Rps19 n/a
7 TRCN0000104260 CCATTTCAGCAGAGGCTCTAA pLKO.1 562 CDS 100% 4.950 2.970 N Rps19 n/a
8 TRCN0000104261 CCCATATGATGAGAACTGGTT pLKO.1 430 CDS 100% 0.000 0.000 N Rps19 n/a
9 TRCN0000351121 AGTCAAGCTGGCCAAACATAA pLKO_005 400 CDS 100% 13.200 6.600 Y Rps19 n/a
10 TRCN0000104262 CTGGCCAAACATAAAGAGCTT pLKO.1 407 CDS 100% 2.640 1.320 Y Rps19 n/a
11 TRCN0000074915 CAGCAGGAGTTCGTCAGAGCT pLKO.1 323 CDS 100% 0.880 0.440 Y RPS19 n/a
12 TRCN0000363690 CAGCAGGAGTTCGTCAGAGCT pLKO_005 323 CDS 100% 0.880 0.440 Y RPS19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01457 pDONR223 100% 93.3% 99.3% None (many diffs) n/a
2 ccsbBroad304_01457 pLX_304 0% 93.3% 99.3% V5 (many diffs) n/a
3 TRCN0000465834 TTTAGGACTAAAAGTTTGTCTACT pLX_317 54.9% 93.3% 99.3% V5 (many diffs) n/a
Download CSV