Transcript: Human NR_002453.5

Homo sapiens SMG1 pseudogene 5 (SMG1P5), non-coding RNA.

Source:
NCBI, updated 2018-05-10
Taxon:
Homo sapiens (human)
Gene:
SMG1P5 (595101)
Length:
2391
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002453.5
NBCI Gene record:
SMG1P5 (595101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002453.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244935 CTCGATGTTACCCTCATATTT pLKO_005 1219 3UTR 100% 15.000 7.500 Y SMG1 n/a
2 TRCN0000082411 GCCACCAAAGACATGAGGAAA pLKO.1 693 3UTR 100% 4.950 2.475 Y NPIPB4 n/a
3 TRCN0000183297 GCTTGAAGAATATTCCTGTTT pLKO.1 1968 3UTR 100% 4.950 2.475 Y BOLA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002453.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10398 pDONR223 100% 19.9% None 1_320del;798_2391del n/a
2 ccsbBroad304_10398 pLX_304 0% 19.9% V5 1_320del;798_2391del n/a
3 TRCN0000474199 GATTATACATTTATGTAATCCGTA pLX_317 93.9% 19.9% V5 1_320del;798_2391del n/a
4 TRCN0000488255 ACGTTGGAAAGGGAAAGCTGGCTT pLX_317 1.7% 17.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV