Transcript: Human NM_001321978.1

Homo sapiens decaprenyl diphosphate synthase subunit 1 (PDSS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PDSS1 (23590)
Length:
1685
CDS:
289..1209

Additional Resources:

NCBI RefSeq record:
NM_001321978.1
NBCI Gene record:
PDSS1 (23590)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312656 TTGTCTCAGATACCCTATATT pLKO_005 442 CDS 100% 15.000 21.000 N PDSS1 n/a
2 TRCN0000036350 CCGATCCTTTCAAACTCGGTT pLKO.1 566 CDS 100% 2.640 3.696 N PDSS1 n/a
3 TRCN0000312714 ACTTATTGATGGGCAATTTAT pLKO_005 1463 3UTR 100% 15.000 12.000 N PDSS1 n/a
4 TRCN0000312657 TGGTTCACGATGACGTTATTG pLKO_005 818 CDS 100% 13.200 10.560 N PDSS1 n/a
5 TRCN0000036353 CTGTTCTTGCTGGAGATTTAA pLKO.1 899 CDS 100% 15.000 10.500 N PDSS1 n/a
6 TRCN0000327877 CTGTTCTTGCTGGAGATTTAA pLKO_005 899 CDS 100% 15.000 10.500 N PDSS1 n/a
7 TRCN0000312658 GAAAGCCTTTCGACCAATTAT pLKO_005 687 CDS 100% 15.000 10.500 N PDSS1 n/a
8 TRCN0000374458 CTGATAGCCAACAGTTGTAAA pLKO_005 1096 CDS 100% 13.200 9.240 N Pdss1 n/a
9 TRCN0000036349 GCAATAAGAGAGATCAGTAAA pLKO.1 1256 3UTR 100% 13.200 9.240 N PDSS1 n/a
10 TRCN0000036351 CCATAGCCTTAATTGCAGAAA pLKO.1 779 CDS 100% 4.950 3.465 N PDSS1 n/a
11 TRCN0000036352 CCAGAAAGAGATGCCCTCATT pLKO.1 1289 3UTR 100% 4.950 2.970 N PDSS1 n/a
12 TRCN0000099016 CCAGAAATGAATGCTATGATA pLKO.1 1127 CDS 100% 5.625 3.938 N Pdss1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11752 pDONR223 100% 99.8% 99.6% None 89G>T n/a
2 ccsbBroad304_11752 pLX_304 0% 99.8% 99.6% V5 89G>T n/a
3 TRCN0000480249 ACCTTGCTTTTATCTCTCATGCCC pLX_317 44.2% 99.8% 99.6% V5 89G>T n/a
Download CSV