Transcript: Human XM_011510407.2

PREDICTED: Homo sapiens ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 (ASAP2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASAP2 (8853)
Length:
5360
CDS:
82..3009

Additional Resources:

NCBI RefSeq record:
XM_011510407.2
NBCI Gene record:
ASAP2 (8853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379573 GAAATAAGCGGAGCGGAAATT pLKO_005 643 CDS 100% 13.200 18.480 N ASAP2 n/a
2 TRCN0000379717 GATCCTGCCTCTACGGAATTA pLKO_005 3285 3UTR 100% 13.200 18.480 N ASAP2 n/a
3 TRCN0000353707 GCGGGTGAAAGCGCTCTATAA pLKO_005 2829 CDS 100% 13.200 18.480 N ASAP2 n/a
4 TRCN0000381484 AGCTACAGATGTGCGAGTATC pLKO_005 698 CDS 100% 10.800 15.120 N ASAP2 n/a
5 TRCN0000029753 CCGGTGTCATTTGTGCACTTT pLKO.1 2977 CDS 100% 4.950 3.960 N ASAP2 n/a
6 TRCN0000330986 CCGGTGTCATTTGTGCACTTT pLKO_005 2977 CDS 100% 4.950 3.960 N ASAP2 n/a
7 TRCN0000331049 GTTGATACAGCTTCGAGATAT pLKO_005 909 CDS 100% 13.200 9.240 N ASAP2 n/a
8 TRCN0000330988 TATGTTCCTGTTTCGTTATTG pLKO_005 3038 3UTR 100% 13.200 9.240 N ASAP2 n/a
9 TRCN0000380947 TTCGTCAGAGCACAGCTTATA pLKO_005 983 CDS 100% 13.200 9.240 N ASAP2 n/a
10 TRCN0000093246 CGAGACCCATGAGGACTACAA pLKO.1 117 CDS 100% 4.950 3.465 N 1700030C10Rik n/a
11 TRCN0000029752 CCCTTTGGACAGTTTGCTGAA pLKO.1 489 CDS 100% 4.050 2.835 N ASAP2 n/a
12 TRCN0000029750 CCTGGATAAACAGACAGGGAA pLKO.1 1962 CDS 100% 2.640 1.848 N ASAP2 n/a
13 TRCN0000029749 GCCTCAAACCTTCCATTGAAA pLKO.1 833 CDS 100% 5.625 3.375 N ASAP2 n/a
14 TRCN0000331046 GCCTCAAACCTTCCATTGAAA pLKO_005 833 CDS 100% 5.625 3.375 N ASAP2 n/a
15 TRCN0000243553 GAGACCCATGAGGACTACAAG pLKO_005 118 CDS 100% 4.950 2.970 N Gm9222 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07314 pDONR223 100% 98.4% 98.3% None (many diffs) n/a
2 ccsbBroad304_07314 pLX_304 0% 98.4% 98.3% V5 (many diffs) n/a
3 TRCN0000465586 TGACTTTAATCGCTTTACTTAGAA pLX_317 12.1% 98.4% 98.3% V5 (many diffs) n/a
Download CSV