Transcript: Human XM_011545856.2

PREDICTED: Homo sapiens NADH:ubiquinone oxidoreductase subunit AB1 (NDUFAB1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDUFAB1 (4706)
Length:
773
CDS:
40..603

Additional Resources:

NCBI RefSeq record:
XM_011545856.2
NBCI Gene record:
NDUFAB1 (4706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027151 CCGTGTTCTTTACGTATTGAA pLKO.1 375 CDS 100% 5.625 7.875 N NDUFAB1 n/a
2 TRCN0000027184 TGCAGATAAGAAGGATGTATA pLKO.1 576 CDS 100% 13.200 9.240 N NDUFAB1 n/a
3 TRCN0000027196 GTCCACAAGAAATTGTAGATT pLKO.1 551 CDS 100% 5.625 3.938 N NDUFAB1 n/a
4 TRCN0000027137 GAGATTATCATGGCCATGGAA pLKO.1 481 CDS 100% 3.000 2.100 N NDUFAB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06623 pDONR223 100% 83.2% 82.8% None 168_260del;487G>T n/a
2 ccsbBroad304_06623 pLX_304 0% 83.2% 82.8% V5 168_260del;487G>T n/a
3 TRCN0000476878 ACTATAGTGTGCTCAATCGCCACC pLX_317 76% 83.2% 82.8% V5 168_260del;487G>T n/a
Download CSV