Transcript: Human XM_005265382.4

PREDICTED: Homo sapiens semaphorin 3F (SEMA3F), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA3F (6405)
Length:
3360
CDS:
136..2400

Additional Resources:

NCBI RefSeq record:
XM_005265382.4
NBCI Gene record:
SEMA3F (6405)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265382.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373417 GGAACCTTCACGCCATCTATG pLKO_005 1285 CDS 100% 10.800 15.120 N SEMA3F n/a
2 TRCN0000061630 CGACTACCGAATCTTGCTCAA pLKO.1 300 CDS 100% 4.050 5.670 N SEMA3F n/a
3 TRCN0000373416 TGCTGGTGTGTACATCGATTT pLKO_005 699 CDS 100% 10.800 8.640 N SEMA3F n/a
4 TRCN0000061632 AGCCACTGAGAACAACTTTAA pLKO.1 2079 CDS 100% 13.200 9.240 N SEMA3F n/a
5 TRCN0000061631 GCGCAATGATGATAAGCTTTA pLKO.1 849 CDS 100% 10.800 7.560 N SEMA3F n/a
6 TRCN0000061628 CCTGTCATTTACGCTGTCTTT pLKO.1 1099 CDS 100% 4.950 3.465 N SEMA3F n/a
7 TRCN0000061629 GCTCTCATTCAAAGAGCTGAA pLKO.1 234 CDS 100% 0.405 0.284 N SEMA3F n/a
8 TRCN0000373485 TCTACTCCATGGCTGATATTC pLKO_005 1160 CDS 100% 13.200 7.920 N SEMA3F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265382.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06931 pDONR223 100% 96% 95.9% None 452_453ins93;1414T>A n/a
Download CSV