Transcript: Human XM_017004495.1

PREDICTED: Homo sapiens allantoicase (ALLC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALLC (55821)
Length:
2524
CDS:
1037..2416

Additional Resources:

NCBI RefSeq record:
XM_017004495.1
NBCI Gene record:
ALLC (55821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430685 TTGGGCACCCAAACAATATAA pLKO_005 1884 CDS 100% 15.000 21.000 N ALLC n/a
2 TRCN0000050465 CCAAGTTGTCTCCCAACCAAA pLKO.1 2211 CDS 100% 4.950 6.930 N ALLC n/a
3 TRCN0000050464 CCTGGAGTAATAACTCGAATT pLKO.1 2045 CDS 100% 0.000 0.000 N ALLC n/a
4 TRCN0000050463 CCGTGCTTCAAAGAGCATGAA pLKO.1 1334 CDS 100% 4.950 3.465 N ALLC n/a
5 TRCN0000050467 GACTCATATCAGACTCAACAT pLKO.1 1723 CDS 100% 4.950 3.465 N ALLC n/a
6 TRCN0000050466 GTTTCTTACTTCACGGGAGAT pLKO.1 1475 CDS 100% 4.050 2.835 N ALLC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14210 pDONR223 100% 88.8% 88.4% None (many diffs) n/a
2 ccsbBroad304_14210 pLX_304 0% 88.8% 88.4% V5 (many diffs) n/a
Download CSV