Transcript: Human XM_011523469.2

PREDICTED: Homo sapiens coiled-coil domain containing 102A (CCDC102A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC102A (92922)
Length:
3709
CDS:
1494..3146

Additional Resources:

NCBI RefSeq record:
XM_011523469.2
NBCI Gene record:
CCDC102A (92922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168576 GTGGAAAGGAAGCCTATGTTT pLKO.1 3316 3UTR 100% 5.625 3.938 N CCDC102A n/a
2 TRCN0000168718 GTTGAGCAGGAACATTGAGAA pLKO.1 2318 CDS 100% 4.950 3.465 N CCDC102A n/a
3 TRCN0000415443 TCAGCCAGTGGAAGATCAAGT pLKO_005 2353 CDS 100% 4.950 3.465 N CCDC102A n/a
4 TRCN0000168577 GCATCTGAAAGTATGGCAGAT pLKO.1 3591 3UTR 100% 0.405 0.284 N CCDC102A n/a
5 TRCN0000172972 GAAGAAGCAGTTCCAGGAGAA pLKO.1 2777 CDS 100% 4.050 2.430 N CCDC102A n/a
6 TRCN0000346823 CCAAGCAGGAGATGCTCAAAC pLKO_005 2392 CDS 100% 10.800 7.560 N Ccdc102a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477301 TCTGAATATCTTACGAAATCTAGC pLX_317 14.2% 99% 1.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV