Transcript: Human XM_011536671.2

PREDICTED: Homo sapiens glutathione S-transferase zeta 1 (GSTZ1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSTZ1 (2954)
Length:
1117
CDS:
190..717

Additional Resources:

NCBI RefSeq record:
XM_011536671.2
NBCI Gene record:
GSTZ1 (2954)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036121 ACAGCGGGCATATACTGTGTA pLKO.1 511 CDS 100% 4.950 3.465 N GSTZ1 n/a
2 TRCN0000300625 ACAGCGGGCATATACTGTGTA pLKO_005 511 CDS 100% 4.950 3.465 N GSTZ1 n/a
3 TRCN0000036119 GCTGAAAGATTCAAGGTGGAT pLKO.1 583 CDS 100% 2.640 1.848 N GSTZ1 n/a
4 TRCN0000300689 GCTGAAAGATTCAAGGTGGAT pLKO_005 583 CDS 100% 2.640 1.848 N GSTZ1 n/a
5 TRCN0000036123 GCAGCCAGATACACCCACTGA pLKO.1 684 CDS 100% 0.880 0.616 N GSTZ1 n/a
6 TRCN0000300624 GCAGCCAGATACACCCACTGA pLKO_005 684 CDS 100% 0.880 0.616 N GSTZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00704 pDONR223 100% 79.5% 78.8% None (many diffs) n/a
2 ccsbBroad304_00704 pLX_304 0% 79.5% 78.8% V5 (many diffs) n/a
3 TRCN0000472290 CGCTCCGATCACATACCGGGAGTC pLX_317 71.1% 79.5% 78.8% V5 (many diffs) n/a
Download CSV