Transcript: Human XM_017012155.1

PREDICTED: Homo sapiens CASTOR family member 3 (CASTOR3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASTOR3 (352954)
Length:
2737
CDS:
170..814

Additional Resources:

NCBI RefSeq record:
XM_017012155.1
NBCI Gene record:
CASTOR3 (352954)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352396 CACTGGCTGACCAGAACATAT pLKO_005 519 CDS 100% 13.200 6.600 Y CASTOR2 n/a
2 TRCN0000337256 ACTGGCTGACCAGAACATATC pLKO_005 520 CDS 100% 10.800 5.400 Y CASTOR2 n/a
3 TRCN0000337255 CAGAGGATTACACTATCATTG pLKO_005 345 CDS 100% 10.800 5.400 Y CASTOR2 n/a
4 TRCN0000337254 TGTTCATGCTGTCCACGTATC pLKO_005 543 CDS 100% 6.000 3.000 Y CASTOR2 n/a
5 TRCN0000138621 CAAGACCAGGTGCAAGTTCTT pLKO.1 307 CDS 100% 4.950 2.475 Y CASTOR3 n/a
6 TRCN0000137329 GATCAAACTTGCCTTCCTGTT pLKO.1 283 CDS 100% 4.050 2.025 Y CASTOR3 n/a
7 TRCN0000138745 CAGGTGCAAGTTCTTCAGTCT pLKO.1 313 CDS 100% 2.640 1.320 Y CASTOR3 n/a
8 TRCN0000136784 CCAGAACATATCCGTGTTCAT pLKO.1 529 CDS 100% 0.495 0.248 Y CASTOR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13623 pDONR223 100% 69.4% 64.9% None (many diffs) n/a
2 ccsbBroad304_13623 pLX_304 0% 69.4% 64.9% V5 (many diffs) n/a
3 TRCN0000477107 CCCCAGACCGATGGGTCGTTCCAT pLX_317 67.1% 69.4% 64.9% V5 (many diffs) n/a
Download CSV