Transcript: Human XM_011524296.2

PREDICTED: Homo sapiens USH1 protein network component sans (USH1G), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USH1G (124590)
Length:
3539
CDS:
473..1549

Additional Resources:

NCBI RefSeq record:
XM_011524296.2
NBCI Gene record:
USH1G (124590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118963 CCATGGTGTTCCGCAGAAATT pLKO.1 1104 CDS 100% 13.200 18.480 N USH1G n/a
2 TRCN0000420676 TGGAGGACACAGAGCTATAAC pLKO_005 1530 CDS 100% 13.200 18.480 N USH1G n/a
3 TRCN0000118965 CCCTGGGATGAGCTCGATTTA pLKO.1 1280 CDS 100% 13.200 9.240 N USH1G n/a
4 TRCN0000438092 TGGTGCCTAGACAACGACTAC pLKO_005 437 5UTR 100% 4.050 2.835 N USH1G n/a
5 TRCN0000118962 CCTGCATTGTTGTGAAGGGAA pLKO.1 1985 3UTR 100% 2.640 1.848 N USH1G n/a
6 TRCN0000118964 CCACATGGAATGCGTGCGCTA pLKO.1 490 CDS 100% 0.720 0.504 N USH1G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04787 pDONR223 100% 77.6% 77.6% None 0_1ins309 n/a
2 ccsbBroad304_04787 pLX_304 0% 77.6% 77.6% V5 0_1ins309 n/a
3 TRCN0000465942 TGCTTACAGAATAAAATTAACGGA pLX_317 17% 77.6% 77.6% V5 0_1ins309 n/a
Download CSV