Transcript: Human XM_011532022.2

PREDICTED: Homo sapiens HECT and RLD domain containing E3 ubiquitin protein ligase 5 (HERC5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HERC5 (51191)
Length:
3808
CDS:
214..3516

Additional Resources:

NCBI RefSeq record:
XM_011532022.2
NBCI Gene record:
HERC5 (51191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004171 GCGACGAAGACATTATCAAAT pLKO.1 3116 CDS 100% 13.200 18.480 N HERC5 n/a
2 TRCN0000284905 GCGACGAAGACATTATCAAAT pLKO_005 3116 CDS 100% 13.200 18.480 N HERC5 n/a
3 TRCN0000010859 AGAGGGTTTACTGGCCGGTTA pLKO.1 3677 3UTR 100% 4.050 5.670 N HERC5 n/a
4 TRCN0000284907 AGAGGGTTTACTGGCCGGTTA pLKO_005 3677 3UTR 100% 4.050 5.670 N HERC5 n/a
5 TRCN0000273087 ATGGGCAACTTGGTCATAATT pLKO_005 1481 CDS 100% 15.000 10.500 N HERC5 n/a
6 TRCN0000004169 GCTGAGGAGAATGGTAATGTT pLKO.1 2347 CDS 100% 5.625 3.938 N HERC5 n/a
7 TRCN0000004168 GAAGGACTAGACAATCAGAAA pLKO.1 1378 CDS 100% 4.950 3.465 N HERC5 n/a
8 TRCN0000272961 GAAGGACTAGACAATCAGAAA pLKO_005 1378 CDS 100% 4.950 3.465 N HERC5 n/a
9 TRCN0000004170 GATGCCTGTTTATTTGGACTT pLKO.1 1980 CDS 100% 4.050 2.835 N HERC5 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 119 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 119 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08246 pDONR223 100% 80.6% 80.6% None (many diffs) n/a
Download CSV