Transcript: Human XM_017004345.1

PREDICTED: Homo sapiens PMS1 homolog 1, mismatch repair system component (PMS1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PMS1 (5378)
Length:
2955
CDS:
147..2762

Additional Resources:

NCBI RefSeq record:
XM_017004345.1
NBCI Gene record:
PMS1 (5378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235495 ATGGCAATAAAGACCATATAG pLKO_005 1369 CDS 100% 13.200 18.480 N PMS1 n/a
2 TRCN0000235494 GGACCATTACCTAGTACAAAT pLKO_005 975 CDS 100% 13.200 18.480 N PMS1 n/a
3 TRCN0000010072 CTTCGGTGGTCAGTGTTGTAA pLKO.1 202 CDS 100% 5.625 7.875 N PMS1 n/a
4 TRCN0000010066 CAAGCGTAGATGTTAAACTGG pLKO.1 259 CDS 100% 2.640 3.696 N PMS1 n/a
5 TRCN0000235493 CCTCGCAAAGTGATAAGTTAT pLKO_005 2571 CDS 100% 13.200 9.240 N PMS1 n/a
6 TRCN0000235496 GGAACGATACAATAGTCAAAT pLKO_005 1847 CDS 100% 13.200 9.240 N PMS1 n/a
7 TRCN0000235492 TGAAATTGGTTCTGTCATAAA pLKO_005 2793 3UTR 100% 13.200 9.240 N PMS1 n/a
8 TRCN0000010073 ATTACAACAAGAACGGCTGCT pLKO.1 285 CDS 100% 2.160 1.512 N PMS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11039 pDONR223 100% 65.2% 65.1% None 131_132ins183;1674_2159del;2311_2613del n/a
2 ccsbBroad304_11039 pLX_304 0% 65.2% 65.1% V5 131_132ins183;1674_2159del;2311_2613del n/a
3 TRCN0000474660 ATTCTACCGCGGCGAATGCGGTCG pLX_317 27.4% 65.2% 65.1% V5 131_132ins183;1674_2159del;2311_2613del n/a
Download CSV