Transcript: Human XM_005264898.3

PREDICTED: Homo sapiens coiled-coil domain containing 13 (CCDC13), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC13 (152206)
Length:
6971
CDS:
85..2109

Additional Resources:

NCBI RefSeq record:
XM_005264898.3
NBCI Gene record:
CCDC13 (152206)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242504 ACGAGAACGGGCGATTGTATA pLKO_005 359 CDS 100% 13.200 18.480 N CCDC13 n/a
2 TRCN0000172890 GCAGCACAAACGGTTACAGAA pLKO.1 147 CDS 100% 4.950 6.930 N CCDC13 n/a
3 TRCN0000242507 GTGCACTATCTTCGGAATAAA pLKO_005 1450 CDS 100% 15.000 12.000 N CCDC13 n/a
4 TRCN0000242506 AGATTGAACACCTTCGAAATG pLKO_005 320 CDS 100% 10.800 7.560 N CCDC13 n/a
5 TRCN0000242505 CTACCAGAAGAGGCTCCTTAA pLKO_005 2230 3UTR 100% 10.800 7.560 N CCDC13 n/a
6 TRCN0000257166 TGTGCCCGTGGAATCCCAAAT pLKO_005 1911 CDS 100% 10.800 7.560 N CCDC13 n/a
7 TRCN0000172814 GAGGACAGATTTGCCTTCACA pLKO.1 433 CDS 100% 3.000 2.100 N CCDC13 n/a
8 TRCN0000168509 GTTCAAGAGCTTGAGAAGCAA pLKO.1 910 CDS 100% 3.000 2.100 N CCDC13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09683 pDONR223 100% 94.2% 94.1% None 1124A>T;1594_1595ins123 n/a
2 ccsbBroad304_09683 pLX_304 0% 94.2% 94.1% V5 1124A>T;1594_1595ins123 n/a
3 TRCN0000477625 TGGAAACATACTTCTGCTCTCCCA pLX_317 18.9% 94.2% 94.1% V5 1124A>T;1594_1595ins123 n/a
Download CSV