Transcript: Human XM_005269693.4

PREDICTED: Homo sapiens myoferlin (MYOF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYOF (26509)
Length:
7079
CDS:
303..6545

Additional Resources:

NCBI RefSeq record:
XM_005269693.4
NBCI Gene record:
MYOF (26509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269693.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320398 ACGGATGCGAACGGCGATAAA pLKO_005 3162 CDS 100% 13.200 18.480 N MYOF n/a
2 TRCN0000001522 GAAAGAGCTGTGCATTATAAA pLKO.1 6937 3UTR 100% 15.000 10.500 N MYOF n/a
3 TRCN0000320397 GAAAGAGCTGTGCATTATAAA pLKO_005 6937 3UTR 100% 15.000 10.500 N MYOF n/a
4 TRCN0000010628 CCTCTACTCTTTGCCGAACTA pLKO.1 6491 CDS 100% 4.950 3.465 N MYOF n/a
5 TRCN0000320396 CCTCTACTCTTTGCCGAACTA pLKO_005 6491 CDS 100% 4.950 3.465 N MYOF n/a
6 TRCN0000010630 CGAGACTACAGCTTGGATGAA pLKO.1 5466 CDS 100% 4.950 3.465 N MYOF n/a
7 TRCN0000320395 CGAGACTACAGCTTGGATGAA pLKO_005 5466 CDS 100% 4.950 3.465 N MYOF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269693.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11828 pDONR223 100% 75.8% 75.8% None 3670_5178del;5817A>G n/a
2 ccsbBroad304_11828 pLX_304 0% 75.8% 75.8% V5 3670_5178del;5817A>G n/a
3 TRCN0000477521 GTATTAGGCAAGGCAAAGTCGATC pLX_317 8.3% 75.8% 75.8% V5 3670_5178del;5817A>G n/a
Download CSV