Transcript: Human XM_017021391.1

PREDICTED: Homo sapiens F-box protein 34 (FBXO34), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXO34 (55030)
Length:
3383
CDS:
151..2298

Additional Resources:

NCBI RefSeq record:
XM_017021391.1
NBCI Gene record:
FBXO34 (55030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295901 GTCAGCACTTGTCAGACTATT pLKO_005 1625 CDS 100% 13.200 18.480 N FBXO34 n/a
2 TRCN0000073292 CGGTAAAGCATCATCTCGAAA pLKO.1 321 CDS 100% 4.950 6.930 N FBXO34 n/a
3 TRCN0000288689 CGGTAAAGCATCATCTCGAAA pLKO_005 321 CDS 100% 4.950 6.930 N FBXO34 n/a
4 TRCN0000073289 CCACAGCTTTAATCGGGCAAT pLKO.1 2235 CDS 100% 4.050 5.670 N FBXO34 n/a
5 TRCN0000288691 CCACAGCTTTAATCGGGCAAT pLKO_005 2235 CDS 100% 4.050 5.670 N FBXO34 n/a
6 TRCN0000295853 ACCTAGATACACCGTTCAAAT pLKO_005 2347 3UTR 100% 13.200 10.560 N FBXO34 n/a
7 TRCN0000073290 CCACATAACATCAAGTGTCTT pLKO.1 285 CDS 100% 4.950 3.465 N FBXO34 n/a
8 TRCN0000073288 GCTGTGAATAACTGCCTGTTT pLKO.1 2541 3UTR 100% 4.950 3.465 N FBXO34 n/a
9 TRCN0000073291 CCAAGAGTTTAGTGGCCCTTA pLKO.1 1937 CDS 100% 4.050 2.835 N FBXO34 n/a
10 TRCN0000288690 CCAAGAGTTTAGTGGCCCTTA pLKO_005 1937 CDS 100% 4.050 2.835 N FBXO34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03509 pDONR223 100% 99.4% 99.4% None 1_12del n/a
2 ccsbBroad304_03509 pLX_304 0% 99.4% 99.4% V5 1_12del n/a
3 ccsbBroadEn_08458 pDONR223 100% 99.3% 99.1% None (many diffs) n/a
4 ccsbBroad304_08458 pLX_304 0% 99.3% 99.1% V5 (many diffs) n/a
Download CSV