Transcript: Human XM_017028943.1

PREDICTED: Homo sapiens TraB domain containing (TRABD), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRABD (80305)
Length:
1787
CDS:
165..1316

Additional Resources:

NCBI RefSeq record:
XM_017028943.1
NBCI Gene record:
TRABD (80305)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184393 CGACGTCTACCTAACCTACAT pLKO.1 953 CDS 100% 4.950 6.930 N TRABD n/a
2 TRCN0000275696 GACGTCTACCTAACCTACATG pLKO_005 954 CDS 100% 4.950 6.930 N TRABD n/a
3 TRCN0000148862 CCTTAAATCCAAAGGGAGAGA pLKO.1 1339 3UTR 100% 2.640 2.112 N TRABD n/a
4 TRCN0000275621 CCTTAAATCCAAAGGGAGAGA pLKO_005 1339 3UTR 100% 2.640 2.112 N TRABD n/a
5 TRCN0000275622 AGATGATGGCCGAGATGATTG pLKO_005 892 CDS 100% 10.800 7.560 N TRABD n/a
6 TRCN0000122581 CTGCCAATATCGTGTGTCCAT pLKO.1 485 CDS 100% 2.640 1.848 N TRABD n/a
7 TRCN0000122366 CGCTGCAAGCAGAAGGACCTA pLKO.1 864 CDS 100% 0.880 0.616 N TRABD n/a
8 TRCN0000275620 CGCTGCAAGCAGAAGGACCTA pLKO_005 864 CDS 100% 0.880 0.616 N TRABD n/a
9 TRCN0000251034 AGTTCAGGGAGGCCTTCAAAG pLKO_005 673 CDS 100% 10.800 7.560 N Trabd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12690 pDONR223 100% 86% 86.1% None 81_218del;530_541del;1140_1149delAGAGAAAAACinsG n/a
2 ccsbBroad304_12690 pLX_304 0% 86% 86.1% V5 81_218del;530_541del;1140_1149delAGAGAAAAACinsG n/a
3 TRCN0000481519 TAATGAGTTTGACGAACTTCATAA pLX_317 33.6% 86% 86.1% V5 81_218del;530_541del;1140_1149delAGAGAAAAACinsG n/a
Download CSV