Transcript: Human XM_017009868.1

PREDICTED: Homo sapiens pentatricopeptide repeat domain 2 (PTCD2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTCD2 (79810)
Length:
1798
CDS:
329..925

Additional Resources:

NCBI RefSeq record:
XM_017009868.1
NBCI Gene record:
PTCD2 (79810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134398 GCTCTACTCAAAGGAGAAATT pLKO.1 557 CDS 100% 13.200 9.240 N PTCD2 n/a
2 TRCN0000134629 GCATTAGCTCTGAATCAGAAT pLKO.1 608 CDS 100% 4.950 3.465 N PTCD2 n/a
3 TRCN0000136023 GAAGCTCTACTCAAAGGAGAA pLKO.1 554 CDS 100% 4.050 2.835 N PTCD2 n/a
4 TRCN0000135733 CCAAGATGTGAAGTTCACCAA pLKO.1 451 CDS 100% 2.640 1.848 N PTCD2 n/a
5 TRCN0000134514 GAATCAGAATGAGATGGCAAA pLKO.1 619 CDS 100% 4.050 2.430 N PTCD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12623 pDONR223 100% 83.8% 83.8% None 372_373ins114 n/a
2 ccsbBroad304_12623 pLX_304 0% 83.8% 83.8% V5 372_373ins114 n/a
3 TRCN0000471465 GACGCACCCTGTTGTAATCACGAG pLX_317 72.3% 83.8% 83.8% V5 372_373ins114 n/a
Download CSV