Transcript: Human XM_017002538.1

PREDICTED: Homo sapiens EF-hand calcium binding domain 2 (EFCAB2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFCAB2 (84288)
Length:
3489
CDS:
58..549

Additional Resources:

NCBI RefSeq record:
XM_017002538.1
NBCI Gene record:
EFCAB2 (84288)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056438 GAGTCGAATAATACAGTGGAT pLKO.1 172 CDS 100% 2.640 3.696 N EFCAB2 n/a
2 TRCN0000056439 GATTCAGCTAAACGTGGGTTT pLKO.1 400 CDS 100% 4.050 3.240 N EFCAB2 n/a
3 TRCN0000056440 CTTCCGGTGATGACAGAAATA pLKO.1 316 CDS 100% 13.200 9.240 N EFCAB2 n/a
4 TRCN0000056441 TGGAACAATTATCAGGTCATT pLKO.1 204 CDS 100% 4.950 3.465 N EFCAB2 n/a
5 TRCN0000127601 CGCTTGTAATCCCAGCACTTT pLKO.1 3446 3UTR 100% 4.950 2.475 Y CCDC30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09177 pDONR223 100% 73.7% 70.2% None (many diffs) n/a
2 ccsbBroad304_09177 pLX_304 0% 73.7% 70.2% V5 (many diffs) n/a
3 TRCN0000475986 GGCTTAACTGACACAGGATACTTT pLX_317 57.9% 73.7% 70.2% V5 (many diffs) n/a
Download CSV