Transcript: Human XM_017015946.1

PREDICTED: Homo sapiens Kin17 DNA and RNA binding protein (KIN), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIN (22944)
Length:
4012
CDS:
284..1147

Additional Resources:

NCBI RefSeq record:
XM_017015946.1
NBCI Gene record:
KIN (22944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218083 ATGTCTCATGAGGTATCAAAC pLKO_005 1317 3UTR 100% 10.800 15.120 N KIN n/a
2 TRCN0000218858 GAAATCTGCACTGGATGAAAT pLKO_005 736 CDS 100% 13.200 9.240 N KIN n/a
3 TRCN0000226385 CAACATTGTCTACAACGAATA pLKO_005 238 5UTR 100% 10.800 7.560 N KIN n/a
4 TRCN0000000066 CAGCTACTATCGTCATTGAAA pLKO.1 1062 CDS 100% 5.625 3.938 N KIN n/a
5 TRCN0000000067 CTGTTGTGAAGATGATTGATT pLKO.1 906 CDS 100% 5.625 3.938 N KIN n/a
6 TRCN0000226386 TGAAGAGAAAGTCACGTTTAA pLKO_005 562 CDS 100% 13.200 7.920 N KIN n/a
7 TRCN0000000068 AGGACGCAGAGTTGAAGGAAT pLKO.1 1096 CDS 100% 4.950 2.970 N KIN n/a
8 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 2761 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
9 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2235 3UTR 100% 10.800 5.400 Y MRPS16 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2832 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2235 3UTR 100% 10.800 5.400 Y CD3EAP n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2832 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14073 pDONR223 100% 73% 2.4% None 0_1ins317 n/a
2 ccsbBroad304_14073 pLX_304 0% 73% 2.4% V5 (not translated due to prior stop codon) 0_1ins317 n/a
Download CSV