Transcript: Human XM_011511482.2

PREDICTED: Homo sapiens Rho GTPase activating protein 15 (ARHGAP15), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP15 (55843)
Length:
1573
CDS:
87..1337

Additional Resources:

NCBI RefSeq record:
XM_011511482.2
NBCI Gene record:
ARHGAP15 (55843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511482.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429280 GGAAGGTCACTGAACCTATAT pLKO_005 235 CDS 100% 13.200 18.480 N ARHGAP15 n/a
2 TRCN0000047253 CCGTGGAAACACTGAATTCTA pLKO.1 115 CDS 100% 0.000 0.000 N ARHGAP15 n/a
3 TRCN0000418065 GATATTGACTTCATCATATTG pLKO_005 600 CDS 100% 13.200 9.240 N ARHGAP15 n/a
4 TRCN0000047257 GCAAGACAACAACACAAGAAT pLKO.1 1229 CDS 100% 5.625 3.938 N ARHGAP15 n/a
5 TRCN0000047255 GACACCATGAAAGTCCTCTTT pLKO.1 1296 CDS 100% 4.950 3.465 N ARHGAP15 n/a
6 TRCN0000047256 GCTCAGCCAAAGTAAATCCAT pLKO.1 197 CDS 100% 3.000 2.100 N ARHGAP15 n/a
7 TRCN0000047254 CCTCTAGCACTGAATTGCTAA pLKO.1 715 CDS 100% 0.495 0.347 N ARHGAP15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511482.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08597 pDONR223 100% 87.4% 86.9% None (many diffs) n/a
2 ccsbBroad304_08597 pLX_304 0% 87.4% 86.9% V5 (many diffs) n/a
3 TRCN0000474228 GGCGATTCGTACCCTCACTGGCGC pLX_317 39.5% 87.4% 86.9% V5 (many diffs) n/a
Download CSV