Transcript: Human XR_001741312.1

PREDICTED: Homo sapiens WD repeat domain 19 (WDR19), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR19 (57728)
Length:
2502
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741312.1
NBCI Gene record:
WDR19 (57728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741312.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422581 GCAACATTGTCTGCTATAATT pLKO_005 759 3UTR 100% 15.000 10.500 N WDR19 n/a
2 TRCN0000129989 GATTGGGATAAAGATGGAGAT pLKO.1 245 3UTR 100% 4.050 2.835 N WDR19 n/a
3 TRCN0000131095 GTTGGAAGTTTCCTGGCTGTT pLKO.1 386 3UTR 100% 4.050 2.835 N WDR19 n/a
4 TRCN0000129774 CGGGTGATTATGTAAATGCTT pLKO.1 2463 3UTR 100% 3.000 2.100 N WDR19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741312.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14236 pDONR223 100% 52.2% None (many diffs) n/a
2 ccsbBroad304_14236 pLX_304 0% 52.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491499 GCGGTGGAGGTTTGCACTACCTTT pLX_317 28.3% 52.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV