Transcript: Human XM_005253376.2

PREDICTED: Homo sapiens mannose-6-phosphate receptor, cation dependent (M6PR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
M6PR (4074)
Length:
2426
CDS:
138..971

Additional Resources:

NCBI RefSeq record:
XM_005253376.2
NBCI Gene record:
M6PR (4074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029687 CTGCCGTTCTAAACCTCGAAA pLKO.1 866 CDS 100% 4.950 6.930 N M6PR n/a
2 TRCN0000322977 CTGCCGTTCTAAACCTCGAAA pLKO_005 866 CDS 100% 4.950 6.930 N M6PR n/a
3 TRCN0000322978 CCTCATCTCACCCTTACTATT pLKO_005 1058 3UTR 100% 13.200 10.560 N M6PR n/a
4 TRCN0000029685 GCCAAAGGAATGGAGCAGTTT pLKO.1 786 CDS 100% 4.950 3.960 N M6PR n/a
5 TRCN0000323053 GCCAAAGGAATGGAGCAGTTT pLKO_005 786 CDS 100% 4.950 3.960 N M6PR n/a
6 TRCN0000029686 CACATCTTCAACGGAAGTAAT pLKO.1 465 CDS 100% 13.200 9.240 N M6PR n/a
7 TRCN0000322975 CACATCTTCAACGGAAGTAAT pLKO_005 465 CDS 100% 13.200 9.240 N M6PR n/a
8 TRCN0000029688 CCAGGGTTCAGACACATACAT pLKO.1 332 CDS 100% 5.625 3.938 N M6PR n/a
9 TRCN0000029684 GCTCTAGTGAAGAGGCTGAAA pLKO.1 276 CDS 100% 4.950 3.465 N M6PR n/a
10 TRCN0000322974 GCTCTAGTGAAGAGGCTGAAA pLKO_005 276 CDS 100% 4.950 3.465 N M6PR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00957 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00957 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473952 CGGATTCAATTTGAATGCTCTTAT pLX_317 52.1% 100% 100% V5 n/a
Download CSV