Transcript: Mouse XM_006508200.3

PREDICTED: Mus musculus NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 (Ndufab1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ndufab1 (70316)
Length:
666
CDS:
55..525

Additional Resources:

NCBI RefSeq record:
XM_006508200.3
NBCI Gene record:
Ndufab1 (70316)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508200.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041882 CCCACTGACGTTAGACGGAAT pLKO.1 270 CDS 100% 4.050 5.670 N Ndufab1 n/a
2 TRCN0000041880 GCTCTCCGTAAATTCTCATTT pLKO.1 345 CDS 100% 13.200 10.560 N Ndufab1 n/a
3 TRCN0000041881 GTTTGGACCAAGTGGAAATTA pLKO.1 389 CDS 100% 15.000 10.500 N Ndufab1 n/a
4 TRCN0000027196 GTCCACAAGAAATTGTAGATT pLKO.1 473 CDS 100% 5.625 3.938 N NDUFAB1 n/a
5 TRCN0000041879 GCAGATAAGAAGGATGTGTAT pLKO.1 499 CDS 100% 4.950 3.465 N Ndufab1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508200.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06623 pDONR223 100% 86.1% 85.2% None (many diffs) n/a
2 ccsbBroad304_06623 pLX_304 0% 86.1% 85.2% V5 (many diffs) n/a
3 TRCN0000476878 ACTATAGTGTGCTCAATCGCCACC pLX_317 76% 86.1% 85.2% V5 (many diffs) n/a
Download CSV