Transcript: Mouse XM_006534552.3

PREDICTED: Mus musculus SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 (Smarcd2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smarcd2 (83796)
Length:
2824
CDS:
284..1939

Additional Resources:

NCBI RefSeq record:
XM_006534552.3
NBCI Gene record:
Smarcd2 (83796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109026 CGCGAGTACATCAACTGCAAT pLKO.1 1391 CDS 100% 4.950 6.930 N Smarcd2 n/a
2 TRCN0000109029 CAATCGTTACTTCCGCCAGAT pLKO.1 1408 CDS 100% 4.050 3.240 N Smarcd2 n/a
3 TRCN0000021266 CCATGATGGATCCATTCCGAA pLKO.1 672 CDS 100% 2.640 2.112 N SMARCD2 n/a
4 TRCN0000319081 CCATGATGGATCCATTCCGAA pLKO_005 672 CDS 100% 2.640 2.112 N SMARCD2 n/a
5 TRCN0000431754 CACTGTGGCTTTACATCAAAC pLKO_005 1344 CDS 100% 10.800 7.560 N Smarcd2 n/a
6 TRCN0000109028 CATCAACTGCAATCGTTACTT pLKO.1 1399 CDS 100% 5.625 3.938 N Smarcd2 n/a
7 TRCN0000109027 CTTCGGATCTATATTTCCAAT pLKO.1 923 CDS 100% 4.950 3.465 N Smarcd2 n/a
8 TRCN0000426465 GCCGAGACCTCAAGATCATCA pLKO_005 1770 CDS 100% 4.950 3.465 N Smarcd2 n/a
9 TRCN0000109025 GCGCTGGCTTTAATTGGGTTT pLKO.1 2147 3UTR 100% 4.050 2.835 N Smarcd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14842 pDONR223 86.8% 78.2% 12.5% None (many diffs) n/a
2 ccsbBroad304_14842 pLX_304 0% 78.2% 12.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477621 TGTAATACAGTTGTACGTCTATAC pLX_317 34.1% 78.2% 12.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV