Transcript: Mouse XM_006520544.3

PREDICTED: Mus musculus megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human) (Mlc1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mlc1 (170790)
Length:
2511
CDS:
135..1373

Additional Resources:

NCBI RefSeq record:
XM_006520544.3
NBCI Gene record:
Mlc1 (170790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102896 CGCTGTGACTACTACGTGTTT pLKO.1 599 CDS 100% 4.950 3.960 N Mlc1 n/a
2 TRCN0000102897 CCAGCCATCAAATCTTATGAT pLKO.1 1125 CDS 100% 5.625 3.938 N Mlc1 n/a
3 TRCN0000060078 CCCAACTTTCAGATATTGTTT pLKO.1 567 CDS 100% 5.625 3.938 N MLC1 n/a
4 TRCN0000102895 CCAGAGAATCAAGGAACCTAT pLKO.1 1810 3UTR 100% 4.950 3.465 N Mlc1 n/a
5 TRCN0000102899 GCTACAAGACATGGGTGTTCT pLKO.1 385 CDS 100% 4.950 3.465 N Mlc1 n/a
6 TRCN0000102898 CGTTTCCTGCTCGGGTCCTAA pLKO.1 808 CDS 100% 1.650 1.155 N Mlc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07856 pDONR223 100% 76.2% 81.1% None (many diffs) n/a
2 ccsbBroad304_07856 pLX_304 0% 76.2% 81.1% V5 (many diffs) n/a
3 TRCN0000472879 AAAACCCCTAGATCTGTACGTACC pLX_317 44.3% 76.2% 81.1% V5 (many diffs) n/a
Download CSV