Transcript: Mouse XM_006526984.3

PREDICTED: Mus musculus GLIS family zinc finger 3 (Glis3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Glis3 (226075)
Length:
3802
CDS:
195..3002

Additional Resources:

NCBI RefSeq record:
XM_006526984.3
NBCI Gene record:
Glis3 (226075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526984.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095874 CGCACGGTATAAACTGCTGAT pLKO.1 1841 CDS 100% 4.050 5.670 N Glis3 n/a
2 TRCN0000095878 CTAAACCTTATGCTTGTCAAA pLKO.1 2065 CDS 100% 4.950 3.960 N Glis3 n/a
3 TRCN0000095877 ACTAAACCTTATGCTTGTCAA pLKO.1 2064 CDS 100% 4.950 3.465 N Glis3 n/a
4 TRCN0000095875 CGGGATCGACTTCAACACTAT pLKO.1 1133 CDS 100% 4.950 3.465 N Glis3 n/a
5 TRCN0000095876 CCAGCAATCATTCAACTCGAA pLKO.1 2350 CDS 100% 2.640 1.848 N Glis3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3776 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526984.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09779 pDONR223 100% 70% 71% None (many diffs) n/a
2 ccsbBroad304_09779 pLX_304 0% 70% 71% V5 (many diffs) n/a
3 TRCN0000468663 TTCTCTACAAAACGCCGTTGCAGT pLX_317 18.9% 70% 71% V5 (many diffs) n/a
Download CSV