Transcript: Mouse XM_006514005.2

PREDICTED: Mus musculus MGAT4 family, member C (Mgat4c), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mgat4c (67569)
Length:
4023
CDS:
99..1535

Additional Resources:

NCBI RefSeq record:
XM_006514005.2
NBCI Gene record:
Mgat4c (67569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514005.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093825 CGGCAGAATGACATCTTACAA pLKO.1 1299 CDS 100% 5.625 7.875 N Mgat4c n/a
2 TRCN0000093826 CCAACTTAATTCTGAACGCTA pLKO.1 284 CDS 100% 2.640 3.696 N Mgat4c n/a
3 TRCN0000093828 GTCCAAGACATTACACAGAAA pLKO.1 555 CDS 100% 4.950 3.960 N Mgat4c n/a
4 TRCN0000093827 CCATCAAGAAAGTCATAGCAT pLKO.1 805 CDS 100% 3.000 2.100 N Mgat4c n/a
5 TRCN0000093824 GCTTTCACTGACTGATGAATT pLKO.1 2009 3UTR 100% 0.000 0.000 N Mgat4c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514005.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07949 pDONR223 100% 88.9% 94.5% None (many diffs) n/a
2 ccsbBroad304_07949 pLX_304 0% 88.9% 94.5% V5 (many diffs) n/a
3 TRCN0000477425 GGGGGGGACAGCACGACATCACTG pLX_317 22.7% 88.9% 94.5% V5 (many diffs) n/a
Download CSV